Virus:Article Title: Genomic deletions explain the generation of alternative BRAF isoforms conferring resistance to MAPK inhibitors in melanoma.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains CaCl2-treated chemically competent cells In-house preparation N/A Chemicals, peptides, and recombinant proteins Vemurafenib (PLX4032) Selleck Chemicals Cat# S1267 Fetal Bovine Serum GibcoTM/Thermo Fisher Inc. Cat# 10270-106 Penicillin-Streptomycin Sigma-Aldrich Cat# P4458 Trypsin-EDTA (0.05%), phenol red GibcoTM/Thermo Fisher Inc. Cat# 25300062 DMEM, high glucose, GlutaMAXTM supplement GibcoTM/Thermo Fisher Inc. Cat# 61965059 RPMI 1650 medium GibcoTM/Thermo Fisher Inc. Cat# 21875091 MCDB 153 medium Sigma-Aldrich Cat# M7403 L-15 medium (Leibovitz) Sigma-Aldrich Cat# L1518 Sodium bicarbonate solution Sigma-Aldrich Cat# S8761 Insulin from bovine pancreas Sigma-Aldrich Cat# I1882 Resazurin sodium salt Sigma-Aldrich Cat# 199303 Dimethyl sulfoxide (DMSO) Sigma-Aldrich Cat# 41647 Dimethyl sulfoxide (DMSO) Cell culture grade PanReac AppliChem Cat# A3672 Opti-MEMTM Reduced Serum Medium GibcoTM/Thermo Fisher Inc. Cat# 31985070 Alt-R HDR Enhancer V2 IDT Cat# 10007910 Critical commercial assays TOPOTM TA CloningTM Kit for Sequencing InvitrogenTM/Thermo Fisher Inc Cat# 450030 Maxwell RSC SimplyRNA Tissue kit Promega Cat# AS1340 RTmax The CRG/UPF Protein Technologies Unit N/A SuperScriptTM III Reverse Transcriptase InvitrogenTM/Thermo Fisher Inc Cat# 18080085 Primer Random pd(N)6 potassium salt Roche Cat# 11034731001 GoTaq G2 Flexi DNA Polymerase Promega Cat# M7801 QIAprep Spin Miniprep Kit Qiagen Cat# 27104 QIAquick Gel Extraction Kit Qiagen Cat# 28706 QIAquick PCR Purification Kit Qiagen Cat# 28104 GenEluteTM Mammalian Genomic DNA Miniprep Kit Sigma-Aldrich Cat# G1N10 Human genomic DNA (Human Mixed) Promega Cat# G3041 Advantage 2 PCR Kit Takara Cat# 639207 DpnI New England Biolabs Inc. Cat# R0176 T4 DNA Ligase New England Biolabs Inc. Cat# M0202 T4 Polynucleotide Kinase New England Biolabs Inc. Cat# M0201 FastDigest BpiI (IIs class) Thermo ScientificTM Cat# FD1014 LipofectamineTM 2000 Transfection Reagent InvitrogenTM/Thermo Fisher Inc Cat# 11668019 KpnI-HF New England Biolabs Inc. Cat# R3142 BamHI New England Biolabs Inc. Cat# R0136 PstI New England Biolabs Inc. Cat# R0140 NotI New England Biolabs Inc. Cat# R0189 Deposited data RNASeq data Hugo et al.16 GEO: GSE65186 RNASeq data Kunz et al.75 GEO: GSE112509 (Continued on next page) Cell Reports --, 114048, --, 2024 13 .. REAGENT or RESOURCE SOURCE IDENTIFIER RNASeq data Tsoi et al.76 GEO: GSE80829 RNASeq data Caltech (Unpublished data) BioProject ID: PRJEB21553 RNASeq data Sanlorenzo et al.77 GEO: GSE99867 RNASeq data M€uller et al.78 GEO: GSE61544 RNASeq data Paudel et al.79 GEO: GSE122041 RNASeq data Song et al.80 GEO: GSE75313 RNASeq data Kemper et al.51 GEO: GSE73738 The Cancer Genome Atlas (TCGA) RNASeq data – Skin Cutaneous Melanoma (Firehose Legacy) NCBI dbGaP Database phs000178.v11.p8 SKMEL-293 whole-genome seq data This paper BioProject ID: PRJNA1002475 BioSample ID: SAMN36845130 SKMEL-293 C3 whole-genome seq data This paper BioProject ID: PRJNA1002475 BioSample ID: SAMN36845131 PRT#4 whole-genome seq data This paper BioProject ID: PRJNA1002475 BioSample ID: SAMN36845132 SK94AR whole-genome seq data This paper BioProject ID: PRJNA1002475 BioSample ID: SAMN36845133 Hartwig Medical Foundation database, version DR-263_update1 Martı́nez-Jiménez et al.35 https://www. hartwigmedicalfoundation.nl/en/ Human reference genome NCBI build 37, GRCh37 Genome Reference Consortium http://www.ncbi.nlm.nih.gov/ projects/ genome/assembly/grc/human/ Human reference genome NCBI build 38, GRCh38 Genome Reference Consortium http://www.ncbi.nlm.nih.gov/ projects/ genome/assembly/grc/human/ Experimental models Human: 293T cells ATCC CRL-1573TM Human: SKMEL-293 Solit and Rosen lab N/A Human: C3 Solit and Rosen lab N/A Human: C3 clone #3 This paper N/A Human: 1205Lu Hartsough lab N/A Human, derived from mouse xenograft: PRT#3 Hartsough lab N/A Human, derived from mouse xenograft: PRT#4 Hartsough lab N/A Human: M397 Ribas lab N/A Human: M397AR Ribas lab N/A Human: UACC-62 Gebauer lab N/A Human: SKMEL-94 Gebauer lab N/A Human: SK94AR This paper N/A Human: SK94AR2 This paper N/A Human: melanocytes (Primary epidermal melanocytes; Normal, Human, Adult; HEMa) Gebauer lab N/A Oligonucleotides Forward Exon 1 GACCCTGCCATTCCGGAG This paper N/A Forward Exon 3 TCTCTGGGGAACGGAACTGA This paper N/A (Continued on next page) 14 Cell Reports --, 114048, --, 2024 OPEN ACCESS
Recombinant:Article Title: Genomic deletions explain the generation of alternative BRAF isoforms conferring resistance to MAPK inhibitors in melanoma.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains CaCl2-treated chemically competent cells In-house preparation N/A Chemicals, peptides, and recombinant proteins Vemurafenib (PLX4032) Selleck Chemicals Cat# S1267 Fetal Bovine Serum GibcoTM/Thermo Fisher Inc. Cat# 10270-106 Penicillin-Streptomycin Sigma-Aldrich Cat# P4458 Trypsin-EDTA (0.05%), phenol red GibcoTM/Thermo Fisher Inc. Cat# 25300062 DMEM, high glucose, GlutaMAXTM supplement GibcoTM/Thermo Fisher Inc. Cat# 61965059 RPMI 1650 medium GibcoTM/Thermo Fisher Inc. Cat# 21875091 MCDB 153 medium Sigma-Aldrich Cat# M7403 L-15 medium (Leibovitz) Sigma-Aldrich Cat# L1518 Sodium bicarbonate solution Sigma-Aldrich Cat# S8761 Insulin from bovine pancreas Sigma-Aldrich Cat# I1882 Resazurin sodium salt Sigma-Aldrich Cat# 199303 Dimethyl sulfoxide (DMSO) Sigma-Aldrich Cat# 41647 Dimethyl sulfoxide (DMSO) Cell culture grade PanReac AppliChem Cat# A3672 Opti-MEMTM Reduced Serum Medium GibcoTM/Thermo Fisher Inc. Cat# 31985070 Alt-R HDR Enhancer V2 IDT Cat# 10007910 Critical commercial assays TOPOTM TA CloningTM Kit for Sequencing InvitrogenTM/Thermo Fisher Inc Cat# 450030 Maxwell RSC SimplyRNA Tissue kit Promega Cat# AS1340 RTmax The CRG/UPF Protein Technologies Unit N/A SuperScriptTM III Reverse Transcriptase InvitrogenTM/Thermo Fisher Inc Cat# 18080085 Primer Random pd(N)6 potassium salt Roche Cat# 11034731001 GoTaq G2 Flexi DNA Polymerase Promega Cat# M7801 QIAprep Spin Miniprep Kit Qiagen Cat# 27104 QIAquick Gel Extraction Kit Qiagen Cat# 28706 QIAquick PCR Purification Kit Qiagen Cat# 28104 GenEluteTM Mammalian Genomic DNA Miniprep Kit Sigma-Aldrich Cat# G1N10 Human genomic DNA (Human Mixed) Promega Cat# G3041 Advantage 2 PCR Kit Takara Cat# 639207 DpnI New England Biolabs Inc. Cat# R0176 T4 DNA Ligase New England Biolabs Inc. Cat# M0202 T4 Polynucleotide Kinase New England Biolabs Inc. Cat# M0201 FastDigest BpiI (IIs class) Thermo ScientificTM Cat# FD1014 LipofectamineTM 2000 Transfection Reagent InvitrogenTM/Thermo Fisher Inc Cat# 11668019 KpnI-HF New England Biolabs Inc. Cat# R3142 BamHI New England Biolabs Inc. Cat# R0136 PstI New England Biolabs Inc. Cat# R0140 NotI New England Biolabs Inc. Cat# R0189 Deposited data RNASeq data Hugo et al.16 GEO: GSE65186 RNASeq data Kunz et al.75 GEO: GSE112509 (Continued on next page) Cell Reports --, 114048, --, 2024 13 .. REAGENT or RESOURCE SOURCE IDENTIFIER RNASeq data Tsoi et al.76 GEO: GSE80829 RNASeq data Caltech (Unpublished data) BioProject ID: PRJEB21553 RNASeq data Sanlorenzo et al.77 GEO: GSE99867 RNASeq data M€uller et al.78 GEO: GSE61544 RNASeq data Paudel et al.79 GEO: GSE122041 RNASeq data Song et al.80 GEO: GSE75313 RNASeq data Kemper et al.51 GEO: GSE73738 The Cancer Genome Atlas (TCGA) RNASeq data – Skin Cutaneous Melanoma (Firehose Legacy) NCBI dbGaP Database phs000178.v11.p8 SKMEL-293 whole-genome seq data This paper BioProject ID: PRJNA1002475 BioSample ID: SAMN36845130 SKMEL-293 C3 whole-genome seq data This paper BioProject ID: PRJNA1002475 BioSample ID: SAMN36845131 PRT#4 whole-genome seq data This paper BioProject ID: PRJNA1002475 BioSample ID: SAMN36845132 SK94AR whole-genome seq data This paper BioProject ID: PRJNA1002475 BioSample ID: SAMN36845133 Hartwig Medical Foundation database, version DR-263_update1 Martı́nez-Jiménez et al.35 https://www. hartwigmedicalfoundation.nl/en/ Human reference genome NCBI build 37, GRCh37 Genome Reference Consortium http://www.ncbi.nlm.nih.gov/ projects/ genome/assembly/grc/human/ Human reference genome NCBI build 38, GRCh38 Genome Reference Consortium http://www.ncbi.nlm.nih.gov/ projects/ genome/assembly/grc/human/ Experimental models Human: 293T cells ATCC CRL-1573TM Human: SKMEL-293 Solit and Rosen lab N/A Human: C3 Solit and Rosen lab N/A Human: C3 clone #3 This paper N/A Human: 1205Lu Hartsough lab N/A Human, derived from mouse xenograft: PRT#3 Hartsough lab N/A Human, derived from mouse xenograft: PRT#4 Hartsough lab N/A Human: M397 Ribas lab N/A Human: M397AR Ribas lab N/A Human: UACC-62 Gebauer lab N/A Human: SKMEL-94 Gebauer lab N/A Human: SK94AR This paper N/A Human: SK94AR2 This paper N/A Human: melanocytes (Primary epidermal melanocytes; Normal, Human, Adult; HEMa) Gebauer lab N/A Oligonucleotides Forward Exon 1 GACCCTGCCATTCCGGAG This paper N/A Forward Exon 3 TCTCTGGGGAACGGAACTGA This paper N/A (Continued on next page) 14 Cell Reports --, 114048, --, 2024 OPEN ACCESS
Cell Culture:Article Title: Genomic deletions explain the generation of alternative BRAF isoforms conferring resistance to MAPK inhibitors in melanoma.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains CaCl2-treated chemically competent cells In-house preparation N/A Chemicals, peptides, and recombinant proteins Vemurafenib (PLX4032) Selleck Chemicals Cat# S1267 Fetal Bovine Serum GibcoTM/Thermo Fisher Inc. Cat# 10270-106 Penicillin-Streptomycin Sigma-Aldrich Cat# P4458 Trypsin-EDTA (0.05%), phenol red GibcoTM/Thermo Fisher Inc. Cat# 25300062 DMEM, high glucose, GlutaMAXTM supplement GibcoTM/Thermo Fisher Inc. Cat# 61965059 RPMI 1650 medium GibcoTM/Thermo Fisher Inc. Cat# 21875091 MCDB 153 medium Sigma-Aldrich Cat# M7403 L-15 medium (Leibovitz) Sigma-Aldrich Cat# L1518 Sodium bicarbonate solution Sigma-Aldrich Cat# S8761 Insulin from bovine pancreas Sigma-Aldrich Cat# I1882 Resazurin sodium salt Sigma-Aldrich Cat# 199303 Dimethyl sulfoxide (DMSO) Sigma-Aldrich Cat# 41647 Dimethyl sulfoxide (DMSO) Cell culture grade PanReac AppliChem Cat# A3672 Opti-MEMTM Reduced Serum Medium GibcoTM/Thermo Fisher Inc. Cat# 31985070 Alt-R HDR Enhancer V2 IDT Cat# 10007910 Critical commercial assays TOPOTM TA CloningTM Kit for Sequencing InvitrogenTM/Thermo Fisher Inc Cat# 450030 Maxwell RSC SimplyRNA Tissue kit Promega Cat# AS1340 RTmax The CRG/UPF Protein Technologies Unit N/A SuperScriptTM III Reverse Transcriptase InvitrogenTM/Thermo Fisher Inc Cat# 18080085 Primer Random pd(N)6 potassium salt Roche Cat# 11034731001 GoTaq G2 Flexi DNA Polymerase Promega Cat# M7801 QIAprep Spin Miniprep Kit Qiagen Cat# 27104 QIAquick Gel Extraction Kit Qiagen Cat# 28706 QIAquick PCR Purification Kit Qiagen Cat# 28104 GenEluteTM Mammalian Genomic DNA Miniprep Kit Sigma-Aldrich Cat# G1N10 Human genomic DNA (Human Mixed) Promega Cat# G3041 Advantage 2 PCR Kit Takara Cat# 639207 DpnI New England Biolabs Inc. Cat# R0176 T4 DNA Ligase New England Biolabs Inc. Cat# M0202 T4 Polynucleotide Kinase New England Biolabs Inc. Cat# M0201 FastDigest BpiI (IIs class) Thermo ScientificTM Cat# FD1014 LipofectamineTM 2000 Transfection Reagent InvitrogenTM/Thermo Fisher Inc Cat# 11668019 KpnI-HF New England Biolabs Inc. Cat# R3142 BamHI New England Biolabs Inc. Cat# R0136 PstI New England Biolabs Inc. Cat# R0140 NotI New England Biolabs Inc. Cat# R0189 Deposited data RNASeq data Hugo et al.16 GEO: GSE65186 RNASeq data Kunz et al.75 GEO: GSE112509 (Continued on next page) Cell Reports --, 114048, --, 2024 13 .. REAGENT or RESOURCE SOURCE IDENTIFIER RNASeq data Tsoi et al.76 GEO: GSE80829 RNASeq data Caltech (Unpublished data) BioProject ID: PRJEB21553 RNASeq data Sanlorenzo et al.77 GEO: GSE99867 RNASeq data M€uller et al.78 GEO: GSE61544 RNASeq data Paudel et al.79 GEO: GSE122041 RNASeq data Song et al.80 GEO: GSE75313 RNASeq data Kemper et al.51 GEO: GSE73738 The Cancer Genome Atlas (TCGA) RNASeq data – Skin Cutaneous Melanoma (Firehose Legacy) NCBI dbGaP Database phs000178.v11.p8 SKMEL-293 whole-genome seq data This paper BioProject ID: PRJNA1002475 BioSample ID: SAMN36845130 SKMEL-293 C3 whole-genome seq data This paper BioProject ID: PRJNA1002475 BioSample ID: SAMN36845131 PRT#4 whole-genome seq data This paper BioProject ID: PRJNA1002475 BioSample ID: SAMN36845132 SK94AR whole-genome seq data This paper BioProject ID: PRJNA1002475 BioSample ID: SAMN36845133 Hartwig Medical Foundation database, version DR-263_update1 Martı́nez-Jiménez et al.35 https://www. hartwigmedicalfoundation.nl/en/ Human reference genome NCBI build 37, GRCh37 Genome Reference Consortium http://www.ncbi.nlm.nih.gov/ projects/ genome/assembly/grc/human/ Human reference genome NCBI build 38, GRCh38 Genome Reference Consortium http://www.ncbi.nlm.nih.gov/ projects/ genome/assembly/grc/human/ Experimental models Human: 293T cells ATCC CRL-1573TM Human: SKMEL-293 Solit and Rosen lab N/A Human: C3 Solit and Rosen lab N/A Human: C3 clone #3 This paper N/A Human: 1205Lu Hartsough lab N/A Human, derived from mouse xenograft: PRT#3 Hartsough lab N/A Human, derived from mouse xenograft: PRT#4 Hartsough lab N/A Human: M397 Ribas lab N/A Human: M397AR Ribas lab N/A Human: UACC-62 Gebauer lab N/A Human: SKMEL-94 Gebauer lab N/A Human: SK94AR This paper N/A Human: SK94AR2 This paper N/A Human: melanocytes (Primary epidermal melanocytes; Normal, Human, Adult; HEMa) Gebauer lab N/A Oligonucleotides Forward Exon 1 GACCCTGCCATTCCGGAG This paper N/A Forward Exon 3 TCTCTGGGGAACGGAACTGA This paper N/A (Continued on next page) 14 Cell Reports --, 114048, --, 2024 OPEN ACCESS
Sequencing:Article Title: Genomic deletions explain the generation of alternative BRAF isoforms conferring resistance to MAPK inhibitors in melanoma.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains CaCl2-treated chemically competent cells In-house preparation N/A Chemicals, peptides, and recombinant proteins Vemurafenib (PLX4032) Selleck Chemicals Cat# S1267 Fetal Bovine Serum GibcoTM/Thermo Fisher Inc. Cat# 10270-106 Penicillin-Streptomycin Sigma-Aldrich Cat# P4458 Trypsin-EDTA (0.05%), phenol red GibcoTM/Thermo Fisher Inc. Cat# 25300062 DMEM, high glucose, GlutaMAXTM supplement GibcoTM/Thermo Fisher Inc. Cat# 61965059 RPMI 1650 medium GibcoTM/Thermo Fisher Inc. Cat# 21875091 MCDB 153 medium Sigma-Aldrich Cat# M7403 L-15 medium (Leibovitz) Sigma-Aldrich Cat# L1518 Sodium bicarbonate solution Sigma-Aldrich Cat# S8761 Insulin from bovine pancreas Sigma-Aldrich Cat# I1882 Resazurin sodium salt Sigma-Aldrich Cat# 199303 Dimethyl sulfoxide (DMSO) Sigma-Aldrich Cat# 41647 Dimethyl sulfoxide (DMSO) Cell culture grade PanReac AppliChem Cat# A3672 Opti-MEMTM Reduced Serum Medium GibcoTM/Thermo Fisher Inc. Cat# 31985070 Alt-R HDR Enhancer V2 IDT Cat# 10007910 Critical commercial assays TOPOTM TA CloningTM Kit for Sequencing InvitrogenTM/Thermo Fisher Inc Cat# 450030 Maxwell RSC SimplyRNA Tissue kit Promega Cat# AS1340 RTmax The CRG/UPF Protein Technologies Unit N/A SuperScriptTM III Reverse Transcriptase InvitrogenTM/Thermo Fisher Inc Cat# 18080085 Primer Random pd(N)6 potassium salt Roche Cat# 11034731001 GoTaq G2 Flexi DNA Polymerase Promega Cat# M7801 QIAprep Spin Miniprep Kit Qiagen Cat# 27104 QIAquick Gel Extraction Kit Qiagen Cat# 28706 QIAquick PCR Purification Kit Qiagen Cat# 28104 GenEluteTM Mammalian Genomic DNA Miniprep Kit Sigma-Aldrich Cat# G1N10 Human genomic DNA (Human Mixed) Promega Cat# G3041 Advantage 2 PCR Kit Takara Cat# 639207 DpnI New England Biolabs Inc. Cat# R0176 T4 DNA Ligase New England Biolabs Inc. Cat# M0202 T4 Polynucleotide Kinase New England Biolabs Inc. Cat# M0201 FastDigest BpiI (IIs class) Thermo ScientificTM Cat# FD1014 LipofectamineTM 2000 Transfection Reagent InvitrogenTM/Thermo Fisher Inc Cat# 11668019 KpnI-HF New England Biolabs Inc. Cat# R3142 BamHI New England Biolabs Inc. Cat# R0136 PstI New England Biolabs Inc. Cat# R0140 NotI New England Biolabs Inc. Cat# R0189 Deposited data RNASeq data Hugo et al.16 GEO: GSE65186 RNASeq data Kunz et al.75 GEO: GSE112509 (Continued on next page) Cell Reports --, 114048, --, 2024 13 .. REAGENT or RESOURCE SOURCE IDENTIFIER RNASeq data Tsoi et al.76 GEO: GSE80829 RNASeq data Caltech (Unpublished data) BioProject ID: PRJEB21553 RNASeq data Sanlorenzo et al.77 GEO: GSE99867 RNASeq data M€uller et al.78 GEO: GSE61544 RNASeq data Paudel et al.79 GEO: GSE122041 RNASeq data Song et al.80 GEO: GSE75313 RNASeq data Kemper et al.51 GEO: GSE73738 The Cancer Genome Atlas (TCGA) RNASeq data – Skin Cutaneous Melanoma (Firehose Legacy) NCBI dbGaP Database phs000178.v11.p8 SKMEL-293 whole-genome seq data This paper BioProject ID: PRJNA1002475 BioSample ID: SAMN36845130 SKMEL-293 C3 whole-genome seq data This paper BioProject ID: PRJNA1002475 BioSample ID: SAMN36845131 PRT#4 whole-genome seq data This paper BioProject ID: PRJNA1002475 BioSample ID: SAMN36845132 SK94AR whole-genome seq data This paper BioProject ID: PRJNA1002475 BioSample ID: SAMN36845133 Hartwig Medical Foundation database, version DR-263_update1 Martı́nez-Jiménez et al.35 https://www. hartwigmedicalfoundation.nl/en/ Human reference genome NCBI build 37, GRCh37 Genome Reference Consortium http://www.ncbi.nlm.nih.gov/ projects/ genome/assembly/grc/human/ Human reference genome NCBI build 38, GRCh38 Genome Reference Consortium http://www.ncbi.nlm.nih.gov/ projects/ genome/assembly/grc/human/ Experimental models Human: 293T cells ATCC CRL-1573TM Human: SKMEL-293 Solit and Rosen lab N/A Human: C3 Solit and Rosen lab N/A Human: C3 clone #3 This paper N/A Human: 1205Lu Hartsough lab N/A Human, derived from mouse xenograft: PRT#3 Hartsough lab N/A Human, derived from mouse xenograft: PRT#4 Hartsough lab N/A Human: M397 Ribas lab N/A Human: M397AR Ribas lab N/A Human: UACC-62 Gebauer lab N/A Human: SKMEL-94 Gebauer lab N/A Human: SK94AR This paper N/A Human: SK94AR2 This paper N/A Human: melanocytes (Primary epidermal melanocytes; Normal, Human, Adult; HEMa) Gebauer lab N/A Oligonucleotides Forward Exon 1 GACCCTGCCATTCCGGAG This paper N/A Forward Exon 3 TCTCTGGGGAACGGAACTGA This paper N/A (Continued on next page) 14 Cell Reports --, 114048, --, 2024 OPEN ACCESS
Reverse Transcription:Article Title: Genomic deletions explain the generation of alternative BRAF isoforms conferring resistance to MAPK inhibitors in melanoma.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains CaCl2-treated chemically competent cells In-house preparation N/A Chemicals, peptides, and recombinant proteins Vemurafenib (PLX4032) Selleck Chemicals Cat# S1267 Fetal Bovine Serum GibcoTM/Thermo Fisher Inc. Cat# 10270-106 Penicillin-Streptomycin Sigma-Aldrich Cat# P4458 Trypsin-EDTA (0.05%), phenol red GibcoTM/Thermo Fisher Inc. Cat# 25300062 DMEM, high glucose, GlutaMAXTM supplement GibcoTM/Thermo Fisher Inc. Cat# 61965059 RPMI 1650 medium GibcoTM/Thermo Fisher Inc. Cat# 21875091 MCDB 153 medium Sigma-Aldrich Cat# M7403 L-15 medium (Leibovitz) Sigma-Aldrich Cat# L1518 Sodium bicarbonate solution Sigma-Aldrich Cat# S8761 Insulin from bovine pancreas Sigma-Aldrich Cat# I1882 Resazurin sodium salt Sigma-Aldrich Cat# 199303 Dimethyl sulfoxide (DMSO) Sigma-Aldrich Cat# 41647 Dimethyl sulfoxide (DMSO) Cell culture grade PanReac AppliChem Cat# A3672 Opti-MEMTM Reduced Serum Medium GibcoTM/Thermo Fisher Inc. Cat# 31985070 Alt-R HDR Enhancer V2 IDT Cat# 10007910 Critical commercial assays TOPOTM TA CloningTM Kit for Sequencing InvitrogenTM/Thermo Fisher Inc Cat# 450030 Maxwell RSC SimplyRNA Tissue kit Promega Cat# AS1340 RTmax The CRG/UPF Protein Technologies Unit N/A SuperScriptTM III Reverse Transcriptase InvitrogenTM/Thermo Fisher Inc Cat# 18080085 Primer Random pd(N)6 potassium salt Roche Cat# 11034731001 GoTaq G2 Flexi DNA Polymerase Promega Cat# M7801 QIAprep Spin Miniprep Kit Qiagen Cat# 27104 QIAquick Gel Extraction Kit Qiagen Cat# 28706 QIAquick PCR Purification Kit Qiagen Cat# 28104 GenEluteTM Mammalian Genomic DNA Miniprep Kit Sigma-Aldrich Cat# G1N10 Human genomic DNA (Human Mixed) Promega Cat# G3041 Advantage 2 PCR Kit Takara Cat# 639207 DpnI New England Biolabs Inc. Cat# R0176 T4 DNA Ligase New England Biolabs Inc. Cat# M0202 T4 Polynucleotide Kinase New England Biolabs Inc. Cat# M0201 FastDigest BpiI (IIs class) Thermo ScientificTM Cat# FD1014 LipofectamineTM 2000 Transfection Reagent InvitrogenTM/Thermo Fisher Inc Cat# 11668019 KpnI-HF New England Biolabs Inc. Cat# R3142 BamHI New England Biolabs Inc. Cat# R0136 PstI New England Biolabs Inc. Cat# R0140 NotI New England Biolabs Inc. Cat# R0189 Deposited data RNASeq data Hugo et al.16 GEO: GSE65186 RNASeq data Kunz et al.75 GEO: GSE112509 (Continued on next page) Cell Reports --, 114048, --, 2024 13 .. REAGENT or RESOURCE SOURCE IDENTIFIER RNASeq data Tsoi et al.76 GEO: GSE80829 RNASeq data Caltech (Unpublished data) BioProject ID: PRJEB21553 RNASeq data Sanlorenzo et al.77 GEO: GSE99867 RNASeq data M€uller et al.78 GEO: GSE61544 RNASeq data Paudel et al.79 GEO: GSE122041 RNASeq data Song et al.80 GEO: GSE75313 RNASeq data Kemper et al.51 GEO: GSE73738 The Cancer Genome Atlas (TCGA) RNASeq data – Skin Cutaneous Melanoma (Firehose Legacy) NCBI dbGaP Database phs000178.v11.p8 SKMEL-293 whole-genome seq data This paper BioProject ID: PRJNA1002475 BioSample ID: SAMN36845130 SKMEL-293 C3 whole-genome seq data This paper BioProject ID: PRJNA1002475 BioSample ID: SAMN36845131 PRT#4 whole-genome seq data This paper BioProject ID: PRJNA1002475 BioSample ID: SAMN36845132 SK94AR whole-genome seq data This paper BioProject ID: PRJNA1002475 BioSample ID: SAMN36845133 Hartwig Medical Foundation database, version DR-263_update1 Martı́nez-Jiménez et al.35 https://www. hartwigmedicalfoundation.nl/en/ Human reference genome NCBI build 37, GRCh37 Genome Reference Consortium http://www.ncbi.nlm.nih.gov/ projects/ genome/assembly/grc/human/ Human reference genome NCBI build 38, GRCh38 Genome Reference Consortium http://www.ncbi.nlm.nih.gov/ projects/ genome/assembly/grc/human/ Experimental models Human: 293T cells ATCC CRL-1573TM Human: SKMEL-293 Solit and Rosen lab N/A Human: C3 Solit and Rosen lab N/A Human: C3 clone #3 This paper N/A Human: 1205Lu Hartsough lab N/A Human, derived from mouse xenograft: PRT#3 Hartsough lab N/A Human, derived from mouse xenograft: PRT#4 Hartsough lab N/A Human: M397 Ribas lab N/A Human: M397AR Ribas lab N/A Human: UACC-62 Gebauer lab N/A Human: SKMEL-94 Gebauer lab N/A Human: SK94AR This paper N/A Human: SK94AR2 This paper N/A Human: melanocytes (Primary epidermal melanocytes; Normal, Human, Adult; HEMa) Gebauer lab N/A Oligonucleotides Forward Exon 1 GACCCTGCCATTCCGGAG This paper N/A Forward Exon 3 TCTCTGGGGAACGGAACTGA This paper N/A (Continued on next page) 14 Cell Reports --, 114048, --, 2024 OPEN ACCESS
Gel Extraction:Article Title: Genomic deletions explain the generation of alternative BRAF isoforms conferring resistance to MAPK inhibitors in melanoma.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains CaCl2-treated chemically competent cells In-house preparation N/A Chemicals, peptides, and recombinant proteins Vemurafenib (PLX4032) Selleck Chemicals Cat# S1267 Fetal Bovine Serum GibcoTM/Thermo Fisher Inc. Cat# 10270-106 Penicillin-Streptomycin Sigma-Aldrich Cat# P4458 Trypsin-EDTA (0.05%), phenol red GibcoTM/Thermo Fisher Inc. Cat# 25300062 DMEM, high glucose, GlutaMAXTM supplement GibcoTM/Thermo Fisher Inc. Cat# 61965059 RPMI 1650 medium GibcoTM/Thermo Fisher Inc. Cat# 21875091 MCDB 153 medium Sigma-Aldrich Cat# M7403 L-15 medium (Leibovitz) Sigma-Aldrich Cat# L1518 Sodium bicarbonate solution Sigma-Aldrich Cat# S8761 Insulin from bovine pancreas Sigma-Aldrich Cat# I1882 Resazurin sodium salt Sigma-Aldrich Cat# 199303 Dimethyl sulfoxide (DMSO) Sigma-Aldrich Cat# 41647 Dimethyl sulfoxide (DMSO) Cell culture grade PanReac AppliChem Cat# A3672 Opti-MEMTM Reduced Serum Medium GibcoTM/Thermo Fisher Inc. Cat# 31985070 Alt-R HDR Enhancer V2 IDT Cat# 10007910 Critical commercial assays TOPOTM TA CloningTM Kit for Sequencing InvitrogenTM/Thermo Fisher Inc Cat# 450030 Maxwell RSC SimplyRNA Tissue kit Promega Cat# AS1340 RTmax The CRG/UPF Protein Technologies Unit N/A SuperScriptTM III Reverse Transcriptase InvitrogenTM/Thermo Fisher Inc Cat# 18080085 Primer Random pd(N)6 potassium salt Roche Cat# 11034731001 GoTaq G2 Flexi DNA Polymerase Promega Cat# M7801 QIAprep Spin Miniprep Kit Qiagen Cat# 27104 QIAquick Gel Extraction Kit Qiagen Cat# 28706 QIAquick PCR Purification Kit Qiagen Cat# 28104 GenEluteTM Mammalian Genomic DNA Miniprep Kit Sigma-Aldrich Cat# G1N10 Human genomic DNA (Human Mixed) Promega Cat# G3041 Advantage 2 PCR Kit Takara Cat# 639207 DpnI New England Biolabs Inc. Cat# R0176 T4 DNA Ligase New England Biolabs Inc. Cat# M0202 T4 Polynucleotide Kinase New England Biolabs Inc. Cat# M0201 FastDigest BpiI (IIs class) Thermo ScientificTM Cat# FD1014 LipofectamineTM 2000 Transfection Reagent InvitrogenTM/Thermo Fisher Inc Cat# 11668019 KpnI-HF New England Biolabs Inc. Cat# R3142 BamHI New England Biolabs Inc. Cat# R0136 PstI New England Biolabs Inc. Cat# R0140 NotI New England Biolabs Inc. Cat# R0189 Deposited data RNASeq data Hugo et al.16 GEO: GSE65186 RNASeq data Kunz et al.75 GEO: GSE112509 (Continued on next page) Cell Reports --, 114048, --, 2024 13 .. REAGENT or RESOURCE SOURCE IDENTIFIER RNASeq data Tsoi et al.76 GEO: GSE80829 RNASeq data Caltech (Unpublished data) BioProject ID: PRJEB21553 RNASeq data Sanlorenzo et al.77 GEO: GSE99867 RNASeq data M€uller et al.78 GEO: GSE61544 RNASeq data Paudel et al.79 GEO: GSE122041 RNASeq data Song et al.80 GEO: GSE75313 RNASeq data Kemper et al.51 GEO: GSE73738 The Cancer Genome Atlas (TCGA) RNASeq data – Skin Cutaneous Melanoma (Firehose Legacy) NCBI dbGaP Database phs000178.v11.p8 SKMEL-293 whole-genome seq data This paper BioProject ID: PRJNA1002475 BioSample ID: SAMN36845130 SKMEL-293 C3 whole-genome seq data This paper BioProject ID: PRJNA1002475 BioSample ID: SAMN36845131 PRT#4 whole-genome seq data This paper BioProject ID: PRJNA1002475 BioSample ID: SAMN36845132 SK94AR whole-genome seq data This paper BioProject ID: PRJNA1002475 BioSample ID: SAMN36845133 Hartwig Medical Foundation database, version DR-263_update1 Martı́nez-Jiménez et al.35 https://www. hartwigmedicalfoundation.nl/en/ Human reference genome NCBI build 37, GRCh37 Genome Reference Consortium http://www.ncbi.nlm.nih.gov/ projects/ genome/assembly/grc/human/ Human reference genome NCBI build 38, GRCh38 Genome Reference Consortium http://www.ncbi.nlm.nih.gov/ projects/ genome/assembly/grc/human/ Experimental models Human: 293T cells ATCC CRL-1573TM Human: SKMEL-293 Solit and Rosen lab N/A Human: C3 Solit and Rosen lab N/A Human: C3 clone #3 This paper N/A Human: 1205Lu Hartsough lab N/A Human, derived from mouse xenograft: PRT#3 Hartsough lab N/A Human, derived from mouse xenograft: PRT#4 Hartsough lab N/A Human: M397 Ribas lab N/A Human: M397AR Ribas lab N/A Human: UACC-62 Gebauer lab N/A Human: SKMEL-94 Gebauer lab N/A Human: SK94AR This paper N/A Human: SK94AR2 This paper N/A Human: melanocytes (Primary epidermal melanocytes; Normal, Human, Adult; HEMa) Gebauer lab N/A Oligonucleotides Forward Exon 1 GACCCTGCCATTCCGGAG This paper N/A Forward Exon 3 TCTCTGGGGAACGGAACTGA This paper N/A (Continued on next page) 14 Cell Reports --, 114048, --, 2024 OPEN ACCESS
Polymerase Chain Reaction:Article Title: Genomic deletions explain the generation of alternative BRAF isoforms conferring resistance to MAPK inhibitors in melanoma.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains CaCl2-treated chemically competent cells In-house preparation N/A Chemicals, peptides, and recombinant proteins Vemurafenib (PLX4032) Selleck Chemicals Cat# S1267 Fetal Bovine Serum GibcoTM/Thermo Fisher Inc. Cat# 10270-106 Penicillin-Streptomycin Sigma-Aldrich Cat# P4458 Trypsin-EDTA (0.05%), phenol red GibcoTM/Thermo Fisher Inc. Cat# 25300062 DMEM, high glucose, GlutaMAXTM supplement GibcoTM/Thermo Fisher Inc. Cat# 61965059 RPMI 1650 medium GibcoTM/Thermo Fisher Inc. Cat# 21875091 MCDB 153 medium Sigma-Aldrich Cat# M7403 L-15 medium (Leibovitz) Sigma-Aldrich Cat# L1518 Sodium bicarbonate solution Sigma-Aldrich Cat# S8761 Insulin from bovine pancreas Sigma-Aldrich Cat# I1882 Resazurin sodium salt Sigma-Aldrich Cat# 199303 Dimethyl sulfoxide (DMSO) Sigma-Aldrich Cat# 41647 Dimethyl sulfoxide (DMSO) Cell culture grade PanReac AppliChem Cat# A3672 Opti-MEMTM Reduced Serum Medium GibcoTM/Thermo Fisher Inc. Cat# 31985070 Alt-R HDR Enhancer V2 IDT Cat# 10007910 Critical commercial assays TOPOTM TA CloningTM Kit for Sequencing InvitrogenTM/Thermo Fisher Inc Cat# 450030 Maxwell RSC SimplyRNA Tissue kit Promega Cat# AS1340 RTmax The CRG/UPF Protein Technologies Unit N/A SuperScriptTM III Reverse Transcriptase InvitrogenTM/Thermo Fisher Inc Cat# 18080085 Primer Random pd(N)6 potassium salt Roche Cat# 11034731001 GoTaq G2 Flexi DNA Polymerase Promega Cat# M7801 QIAprep Spin Miniprep Kit Qiagen Cat# 27104 QIAquick Gel Extraction Kit Qiagen Cat# 28706 QIAquick PCR Purification Kit Qiagen Cat# 28104 GenEluteTM Mammalian Genomic DNA Miniprep Kit Sigma-Aldrich Cat# G1N10 Human genomic DNA (Human Mixed) Promega Cat# G3041 Advantage 2 PCR Kit Takara Cat# 639207 DpnI New England Biolabs Inc. Cat# R0176 T4 DNA Ligase New England Biolabs Inc. Cat# M0202 T4 Polynucleotide Kinase New England Biolabs Inc. Cat# M0201 FastDigest BpiI (IIs class) Thermo ScientificTM Cat# FD1014 LipofectamineTM 2000 Transfection Reagent InvitrogenTM/Thermo Fisher Inc Cat# 11668019 KpnI-HF New England Biolabs Inc. Cat# R3142 BamHI New England Biolabs Inc. Cat# R0136 PstI New England Biolabs Inc. Cat# R0140 NotI New England Biolabs Inc. Cat# R0189 Deposited data RNASeq data Hugo et al.16 GEO: GSE65186 RNASeq data Kunz et al.75 GEO: GSE112509 (Continued on next page) Cell Reports --, 114048, --, 2024 13 .. REAGENT or RESOURCE SOURCE IDENTIFIER RNASeq data Tsoi et al.76 GEO: GSE80829 RNASeq data Caltech (Unpublished data) BioProject ID: PRJEB21553 RNASeq data Sanlorenzo et al.77 GEO: GSE99867 RNASeq data M€uller et al.78 GEO: GSE61544 RNASeq data Paudel et al.79 GEO: GSE122041 RNASeq data Song et al.80 GEO: GSE75313 RNASeq data Kemper et al.51 GEO: GSE73738 The Cancer Genome Atlas (TCGA) RNASeq data – Skin Cutaneous Melanoma (Firehose Legacy) NCBI dbGaP Database phs000178.v11.p8 SKMEL-293 whole-genome seq data This paper BioProject ID: PRJNA1002475 BioSample ID: SAMN36845130 SKMEL-293 C3 whole-genome seq data This paper BioProject ID: PRJNA1002475 BioSample ID: SAMN36845131 PRT#4 whole-genome seq data This paper BioProject ID: PRJNA1002475 BioSample ID: SAMN36845132 SK94AR whole-genome seq data This paper BioProject ID: PRJNA1002475 BioSample ID: SAMN36845133 Hartwig Medical Foundation database, version DR-263_update1 Martı́nez-Jiménez et al.35 https://www. hartwigmedicalfoundation.nl/en/ Human reference genome NCBI build 37, GRCh37 Genome Reference Consortium http://www.ncbi.nlm.nih.gov/ projects/ genome/assembly/grc/human/ Human reference genome NCBI build 38, GRCh38 Genome Reference Consortium http://www.ncbi.nlm.nih.gov/ projects/ genome/assembly/grc/human/ Experimental models Human: 293T cells ATCC CRL-1573TM Human: SKMEL-293 Solit and Rosen lab N/A Human: C3 Solit and Rosen lab N/A Human: C3 clone #3 This paper N/A Human: 1205Lu Hartsough lab N/A Human, derived from mouse xenograft: PRT#3 Hartsough lab N/A Human, derived from mouse xenograft: PRT#4 Hartsough lab N/A Human: M397 Ribas lab N/A Human: M397AR Ribas lab N/A Human: UACC-62 Gebauer lab N/A Human: SKMEL-94 Gebauer lab N/A Human: SK94AR This paper N/A Human: SK94AR2 This paper N/A Human: melanocytes (Primary epidermal melanocytes; Normal, Human, Adult; HEMa) Gebauer lab N/A Oligonucleotides Forward Exon 1 GACCCTGCCATTCCGGAG This paper N/A Forward Exon 3 TCTCTGGGGAACGGAACTGA This paper N/A (Continued on next page) 14 Cell Reports --, 114048, --, 2024 OPEN ACCESS
Purification:Article Title: Genomic deletions explain the generation of alternative BRAF isoforms conferring resistance to MAPK inhibitors in melanoma.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains CaCl2-treated chemically competent cells In-house preparation N/A Chemicals, peptides, and recombinant proteins Vemurafenib (PLX4032) Selleck Chemicals Cat# S1267 Fetal Bovine Serum GibcoTM/Thermo Fisher Inc. Cat# 10270-106 Penicillin-Streptomycin Sigma-Aldrich Cat# P4458 Trypsin-EDTA (0.05%), phenol red GibcoTM/Thermo Fisher Inc. Cat# 25300062 DMEM, high glucose, GlutaMAXTM supplement GibcoTM/Thermo Fisher Inc. Cat# 61965059 RPMI 1650 medium GibcoTM/Thermo Fisher Inc. Cat# 21875091 MCDB 153 medium Sigma-Aldrich Cat# M7403 L-15 medium (Leibovitz) Sigma-Aldrich Cat# L1518 Sodium bicarbonate solution Sigma-Aldrich Cat# S8761 Insulin from bovine pancreas Sigma-Aldrich Cat# I1882 Resazurin sodium salt Sigma-Aldrich Cat# 199303 Dimethyl sulfoxide (DMSO) Sigma-Aldrich Cat# 41647 Dimethyl sulfoxide (DMSO) Cell culture grade PanReac AppliChem Cat# A3672 Opti-MEMTM Reduced Serum Medium GibcoTM/Thermo Fisher Inc. Cat# 31985070 Alt-R HDR Enhancer V2 IDT Cat# 10007910 Critical commercial assays TOPOTM TA CloningTM Kit for Sequencing InvitrogenTM/Thermo Fisher Inc Cat# 450030 Maxwell RSC SimplyRNA Tissue kit Promega Cat# AS1340 RTmax The CRG/UPF Protein Technologies Unit N/A SuperScriptTM III Reverse Transcriptase InvitrogenTM/Thermo Fisher Inc Cat# 18080085 Primer Random pd(N)6 potassium salt Roche Cat# 11034731001 GoTaq G2 Flexi DNA Polymerase Promega Cat# M7801 QIAprep Spin Miniprep Kit Qiagen Cat# 27104 QIAquick Gel Extraction Kit Qiagen Cat# 28706 QIAquick PCR Purification Kit Qiagen Cat# 28104 GenEluteTM Mammalian Genomic DNA Miniprep Kit Sigma-Aldrich Cat# G1N10 Human genomic DNA (Human Mixed) Promega Cat# G3041 Advantage 2 PCR Kit Takara Cat# 639207 DpnI New England Biolabs Inc. Cat# R0176 T4 DNA Ligase New England Biolabs Inc. Cat# M0202 T4 Polynucleotide Kinase New England Biolabs Inc. Cat# M0201 FastDigest BpiI (IIs class) Thermo ScientificTM Cat# FD1014 LipofectamineTM 2000 Transfection Reagent InvitrogenTM/Thermo Fisher Inc Cat# 11668019 KpnI-HF New England Biolabs Inc. Cat# R3142 BamHI New England Biolabs Inc. Cat# R0136 PstI New England Biolabs Inc. Cat# R0140 NotI New England Biolabs Inc. Cat# R0189 Deposited data RNASeq data Hugo et al.16 GEO: GSE65186 RNASeq data Kunz et al.75 GEO: GSE112509 (Continued on next page) Cell Reports --, 114048, --, 2024 13 .. REAGENT or RESOURCE SOURCE IDENTIFIER RNASeq data Tsoi et al.76 GEO: GSE80829 RNASeq data Caltech (Unpublished data) BioProject ID: PRJEB21553 RNASeq data Sanlorenzo et al.77 GEO: GSE99867 RNASeq data M€uller et al.78 GEO: GSE61544 RNASeq data Paudel et al.79 GEO: GSE122041 RNASeq data Song et al.80 GEO: GSE75313 RNASeq data Kemper et al.51 GEO: GSE73738 The Cancer Genome Atlas (TCGA) RNASeq data – Skin Cutaneous Melanoma (Firehose Legacy) NCBI dbGaP Database phs000178.v11.p8 SKMEL-293 whole-genome seq data This paper BioProject ID: PRJNA1002475 BioSample ID: SAMN36845130 SKMEL-293 C3 whole-genome seq data This paper BioProject ID: PRJNA1002475 BioSample ID: SAMN36845131 PRT#4 whole-genome seq data This paper BioProject ID: PRJNA1002475 BioSample ID: SAMN36845132 SK94AR whole-genome seq data This paper BioProject ID: PRJNA1002475 BioSample ID: SAMN36845133 Hartwig Medical Foundation database, version DR-263_update1 Martı́nez-Jiménez et al.35 https://www. hartwigmedicalfoundation.nl/en/ Human reference genome NCBI build 37, GRCh37 Genome Reference Consortium http://www.ncbi.nlm.nih.gov/ projects/ genome/assembly/grc/human/ Human reference genome NCBI build 38, GRCh38 Genome Reference Consortium http://www.ncbi.nlm.nih.gov/ projects/ genome/assembly/grc/human/ Experimental models Human: 293T cells ATCC CRL-1573TM Human: SKMEL-293 Solit and Rosen lab N/A Human: C3 Solit and Rosen lab N/A Human: C3 clone #3 This paper N/A Human: 1205Lu Hartsough lab N/A Human, derived from mouse xenograft: PRT#3 Hartsough lab N/A Human, derived from mouse xenograft: PRT#4 Hartsough lab N/A Human: M397 Ribas lab N/A Human: M397AR Ribas lab N/A Human: UACC-62 Gebauer lab N/A Human: SKMEL-94 Gebauer lab N/A Human: SK94AR This paper N/A Human: SK94AR2 This paper N/A Human: melanocytes (Primary epidermal melanocytes; Normal, Human, Adult; HEMa) Gebauer lab N/A Oligonucleotides Forward Exon 1 GACCCTGCCATTCCGGAG This paper N/A Forward Exon 3 TCTCTGGGGAACGGAACTGA This paper N/A (Continued on next page) 14 Cell Reports --, 114048, --, 2024 OPEN ACCESS
Transfection:Article Title: Genomic deletions explain the generation of alternative BRAF isoforms conferring resistance to MAPK inhibitors in melanoma.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains CaCl2-treated chemically competent cells In-house preparation N/A Chemicals, peptides, and recombinant proteins Vemurafenib (PLX4032) Selleck Chemicals Cat# S1267 Fetal Bovine Serum GibcoTM/Thermo Fisher Inc. Cat# 10270-106 Penicillin-Streptomycin Sigma-Aldrich Cat# P4458 Trypsin-EDTA (0.05%), phenol red GibcoTM/Thermo Fisher Inc. Cat# 25300062 DMEM, high glucose, GlutaMAXTM supplement GibcoTM/Thermo Fisher Inc. Cat# 61965059 RPMI 1650 medium GibcoTM/Thermo Fisher Inc. Cat# 21875091 MCDB 153 medium Sigma-Aldrich Cat# M7403 L-15 medium (Leibovitz) Sigma-Aldrich Cat# L1518 Sodium bicarbonate solution Sigma-Aldrich Cat# S8761 Insulin from bovine pancreas Sigma-Aldrich Cat# I1882 Resazurin sodium salt Sigma-Aldrich Cat# 199303 Dimethyl sulfoxide (DMSO) Sigma-Aldrich Cat# 41647 Dimethyl sulfoxide (DMSO) Cell culture grade PanReac AppliChem Cat# A3672 Opti-MEMTM Reduced Serum Medium GibcoTM/Thermo Fisher Inc. Cat# 31985070 Alt-R HDR Enhancer V2 IDT Cat# 10007910 Critical commercial assays TOPOTM TA CloningTM Kit for Sequencing InvitrogenTM/Thermo Fisher Inc Cat# 450030 Maxwell RSC SimplyRNA Tissue kit Promega Cat# AS1340 RTmax The CRG/UPF Protein Technologies Unit N/A SuperScriptTM III Reverse Transcriptase InvitrogenTM/Thermo Fisher Inc Cat# 18080085 Primer Random pd(N)6 potassium salt Roche Cat# 11034731001 GoTaq G2 Flexi DNA Polymerase Promega Cat# M7801 QIAprep Spin Miniprep Kit Qiagen Cat# 27104 QIAquick Gel Extraction Kit Qiagen Cat# 28706 QIAquick PCR Purification Kit Qiagen Cat# 28104 GenEluteTM Mammalian Genomic DNA Miniprep Kit Sigma-Aldrich Cat# G1N10 Human genomic DNA (Human Mixed) Promega Cat# G3041 Advantage 2 PCR Kit Takara Cat# 639207 DpnI New England Biolabs Inc. Cat# R0176 T4 DNA Ligase New England Biolabs Inc. Cat# M0202 T4 Polynucleotide Kinase New England Biolabs Inc. Cat# M0201 FastDigest BpiI (IIs class) Thermo ScientificTM Cat# FD1014 LipofectamineTM 2000 Transfection Reagent InvitrogenTM/Thermo Fisher Inc Cat# 11668019 KpnI-HF New England Biolabs Inc. Cat# R3142 BamHI New England Biolabs Inc. Cat# R0136 PstI New England Biolabs Inc. Cat# R0140 NotI New England Biolabs Inc. Cat# R0189 Deposited data RNASeq data Hugo et al.16 GEO: GSE65186 RNASeq data Kunz et al.75 GEO: GSE112509 (Continued on next page) Cell Reports --, 114048, --, 2024 13 .. REAGENT or RESOURCE SOURCE IDENTIFIER RNASeq data Tsoi et al.76 GEO: GSE80829 RNASeq data Caltech (Unpublished data) BioProject ID: PRJEB21553 RNASeq data Sanlorenzo et al.77 GEO: GSE99867 RNASeq data M€uller et al.78 GEO: GSE61544 RNASeq data Paudel et al.79 GEO: GSE122041 RNASeq data Song et al.80 GEO: GSE75313 RNASeq data Kemper et al.51 GEO: GSE73738 The Cancer Genome Atlas (TCGA) RNASeq data – Skin Cutaneous Melanoma (Firehose Legacy) NCBI dbGaP Database phs000178.v11.p8 SKMEL-293 whole-genome seq data This paper BioProject ID: PRJNA1002475 BioSample ID: SAMN36845130 SKMEL-293 C3 whole-genome seq data This paper BioProject ID: PRJNA1002475 BioSample ID: SAMN36845131 PRT#4 whole-genome seq data This paper BioProject ID: PRJNA1002475 BioSample ID: SAMN36845132 SK94AR whole-genome seq data This paper BioProject ID: PRJNA1002475 BioSample ID: SAMN36845133 Hartwig Medical Foundation database, version DR-263_update1 Martı́nez-Jiménez et al.35 https://www. hartwigmedicalfoundation.nl/en/ Human reference genome NCBI build 37, GRCh37 Genome Reference Consortium http://www.ncbi.nlm.nih.gov/ projects/ genome/assembly/grc/human/ Human reference genome NCBI build 38, GRCh38 Genome Reference Consortium http://www.ncbi.nlm.nih.gov/ projects/ genome/assembly/grc/human/ Experimental models Human: 293T cells ATCC CRL-1573TM Human: SKMEL-293 Solit and Rosen lab N/A Human: C3 Solit and Rosen lab N/A Human: C3 clone #3 This paper N/A Human: 1205Lu Hartsough lab N/A Human, derived from mouse xenograft: PRT#3 Hartsough lab N/A Human, derived from mouse xenograft: PRT#4 Hartsough lab N/A Human: M397 Ribas lab N/A Human: M397AR Ribas lab N/A Human: UACC-62 Gebauer lab N/A Human: SKMEL-94 Gebauer lab N/A Human: SK94AR This paper N/A Human: SK94AR2 This paper N/A Human: melanocytes (Primary epidermal melanocytes; Normal, Human, Adult; HEMa) Gebauer lab N/A Oligonucleotides Forward Exon 1 GACCCTGCCATTCCGGAG This paper N/A Forward Exon 3 TCTCTGGGGAACGGAACTGA This paper N/A (Continued on next page) 14 Cell Reports --, 114048, --, 2024 OPEN ACCESS
RNA sequencing:Article Title: Genomic deletions explain the generation of alternative BRAF isoforms conferring resistance to MAPK inhibitors in melanoma.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains CaCl2-treated chemically competent cells In-house preparation N/A Chemicals, peptides, and recombinant proteins Vemurafenib (PLX4032) Selleck Chemicals Cat# S1267 Fetal Bovine Serum GibcoTM/Thermo Fisher Inc. Cat# 10270-106 Penicillin-Streptomycin Sigma-Aldrich Cat# P4458 Trypsin-EDTA (0.05%), phenol red GibcoTM/Thermo Fisher Inc. Cat# 25300062 DMEM, high glucose, GlutaMAXTM supplement GibcoTM/Thermo Fisher Inc. Cat# 61965059 RPMI 1650 medium GibcoTM/Thermo Fisher Inc. Cat# 21875091 MCDB 153 medium Sigma-Aldrich Cat# M7403 L-15 medium (Leibovitz) Sigma-Aldrich Cat# L1518 Sodium bicarbonate solution Sigma-Aldrich Cat# S8761 Insulin from bovine pancreas Sigma-Aldrich Cat# I1882 Resazurin sodium salt Sigma-Aldrich Cat# 199303 Dimethyl sulfoxide (DMSO) Sigma-Aldrich Cat# 41647 Dimethyl sulfoxide (DMSO) Cell culture grade PanReac AppliChem Cat# A3672 Opti-MEMTM Reduced Serum Medium GibcoTM/Thermo Fisher Inc. Cat# 31985070 Alt-R HDR Enhancer V2 IDT Cat# 10007910 Critical commercial assays TOPOTM TA CloningTM Kit for Sequencing InvitrogenTM/Thermo Fisher Inc Cat# 450030 Maxwell RSC SimplyRNA Tissue kit Promega Cat# AS1340 RTmax The CRG/UPF Protein Technologies Unit N/A SuperScriptTM III Reverse Transcriptase InvitrogenTM/Thermo Fisher Inc Cat# 18080085 Primer Random pd(N)6 potassium salt Roche Cat# 11034731001 GoTaq G2 Flexi DNA Polymerase Promega Cat# M7801 QIAprep Spin Miniprep Kit Qiagen Cat# 27104 QIAquick Gel Extraction Kit Qiagen Cat# 28706 QIAquick PCR Purification Kit Qiagen Cat# 28104 GenEluteTM Mammalian Genomic DNA Miniprep Kit Sigma-Aldrich Cat# G1N10 Human genomic DNA (Human Mixed) Promega Cat# G3041 Advantage 2 PCR Kit Takara Cat# 639207 DpnI New England Biolabs Inc. Cat# R0176 T4 DNA Ligase New England Biolabs Inc. Cat# M0202 T4 Polynucleotide Kinase New England Biolabs Inc. Cat# M0201 FastDigest BpiI (IIs class) Thermo ScientificTM Cat# FD1014 LipofectamineTM 2000 Transfection Reagent InvitrogenTM/Thermo Fisher Inc Cat# 11668019 KpnI-HF New England Biolabs Inc. Cat# R3142 BamHI New England Biolabs Inc. Cat# R0136 PstI New England Biolabs Inc. Cat# R0140 NotI New England Biolabs Inc. Cat# R0189 Deposited data RNASeq data Hugo et al.16 GEO: GSE65186 RNASeq data Kunz et al.75 GEO: GSE112509 (Continued on next page) Cell Reports --, 114048, --, 2024 13 .. REAGENT or RESOURCE SOURCE IDENTIFIER RNASeq data Tsoi et al.76 GEO: GSE80829 RNASeq data Caltech (Unpublished data) BioProject ID: PRJEB21553 RNASeq data Sanlorenzo et al.77 GEO: GSE99867 RNASeq data M€uller et al.78 GEO: GSE61544 RNASeq data Paudel et al.79 GEO: GSE122041 RNASeq data Song et al.80 GEO: GSE75313 RNASeq data Kemper et al.51 GEO: GSE73738 The Cancer Genome Atlas (TCGA) RNASeq data – Skin Cutaneous Melanoma (Firehose Legacy) NCBI dbGaP Database phs000178.v11.p8 SKMEL-293 whole-genome seq data This paper BioProject ID: PRJNA1002475 BioSample ID: SAMN36845130 SKMEL-293 C3 whole-genome seq data This paper BioProject ID: PRJNA1002475 BioSample ID: SAMN36845131 PRT#4 whole-genome seq data This paper BioProject ID: PRJNA1002475 BioSample ID: SAMN36845132 SK94AR whole-genome seq data This paper BioProject ID: PRJNA1002475 BioSample ID: SAMN36845133 Hartwig Medical Foundation database, version DR-263_update1 Martı́nez-Jiménez et al.35 https://www. hartwigmedicalfoundation.nl/en/ Human reference genome NCBI build 37, GRCh37 Genome Reference Consortium http://www.ncbi.nlm.nih.gov/ projects/ genome/assembly/grc/human/ Human reference genome NCBI build 38, GRCh38 Genome Reference Consortium http://www.ncbi.nlm.nih.gov/ projects/ genome/assembly/grc/human/ Experimental models Human: 293T cells ATCC CRL-1573TM Human: SKMEL-293 Solit and Rosen lab N/A Human: C3 Solit and Rosen lab N/A Human: C3 clone #3 This paper N/A Human: 1205Lu Hartsough lab N/A Human, derived from mouse xenograft: PRT#3 Hartsough lab N/A Human, derived from mouse xenograft: PRT#4 Hartsough lab N/A Human: M397 Ribas lab N/A Human: M397AR Ribas lab N/A Human: UACC-62 Gebauer lab N/A Human: SKMEL-94 Gebauer lab N/A Human: SK94AR This paper N/A Human: SK94AR2 This paper N/A Human: melanocytes (Primary epidermal melanocytes; Normal, Human, Adult; HEMa) Gebauer lab N/A Oligonucleotides Forward Exon 1 GACCCTGCCATTCCGGAG This paper N/A Forward Exon 3 TCTCTGGGGAACGGAACTGA This paper N/A (Continued on next page) 14 Cell Reports --, 114048, --, 2024 OPEN ACCESS
|
Roche manufactures this product 